Modular automated microfluidic cell culture platform reduces glycolytic stress in cerebral cortex organoids
Design and assembly of a system
Design of the Autoculture platform
Cell culture media were stored in Corning glass bottles with a multi-port solvent delivery cap. (4^{circ }hbox {C}) The experiment was continued for the entire duration. Each reservoir delivery cap contained a single 0.030″ ID × 0.090″ OD Tygon microbore tube (Masterflex), sealed by a two-piece PTFE nut and ferrule threaded adapter (Spex VapLock), extending from the bottom of the reservoir to an inlet port on the 6-port ceramic valve head of the syringe pump (Tecan Cavro Centris, 1.0-mL glass vial). The reservoir can be refilled with sterile air by using a 0.22-inch port.(upmu hbox {m}) To compensate for the draw of syringe pump chemicals, the cap has a filter (Millipore). Two 12-port parallel distribution valves (Tecan SmartValve) were connected to the syringe pump using the same Tygon microbore tubing, PTFE nuts and ferrule threaded connectors. Each 0.020″ ID × 0.060″ OD Tygon microbore tube (Masterflex) emanating from the distribution valve connects to a single well of the microfluidic chip. From this junction onwards fluidic isolation between wells remains. Each 12-port distribution valle services six microfluidic chips. There were two- and four distribution valve systems. For easy handling, the 2-m-long microbore tubes were wrapped in a braid and passed through the rear port of a standard panasonic cell culture incubator (Fig. 2(4)). Incubation conditions(37^{circ }hbox {C}), 5% CO2, 95% rel. humidity). A single, 3D-printed fluidic plate, matched the set to microbore tubes to deliver reagent to the microfluidic chips’ inlets. An identical interface plate mate the set to microbore tubs for reagent aspiration from the outlets.
The microbore tubes were used for aspiration and were redirected to an incubator. They were then transferred to a set single-use 15 mL conical tubes (Falcon), for conditioning media collection (Fig. 2(3)). Each collection reservoir was capped with a rubber stopper (McMaster) containing two 0.06” drilled holes. The stoppers were capped with a rubber stopper (McMaster) that contained two holes of 0.06 inches. A dry microbore tube was used for pneumatic operation back to the aspiration distribution head. In order to draw the conditioned media into the collection tank, the syringe pumps was used to apply negative pressure to each collection reservoir in sequence. The collection reservoir was sealed by the separation between the pneumatic tube conditioned media tube. All microbore tubes were hermetically sealed with PTFE nuts and ferrule threaded adapters to the distribution valve.
The multi-pump wiring configuration was used to connect the syringe pump, distribution valves and the syringe pump. A Raspberry Pi 4 compute module sent serial communications to Tecan OEM Communication Protocol by using a GPIO X/RX from DB9M RS232 serial extension board for Raspberry Pi. The Raspberry Pi compute module used a 7” touchscreen display to edit and launch protocols. To develop the software needed to automate protocols, an open-source Python program interface (API), was used.29.
Molding using PDMS
Fig. 4: PDMS-based microfluidics were built using an interlocking 3D printed plastic mold (Fig. 4). These were printed on an SLA printer (Formlabs Form3) using Model V2 resin. To remove excess resin from the printed molds, they were then post-processed in isopropanol for 20 minutes. Next, N2 was used to dry them. The components were dried under UV-light (405nm) for 30 minutes (60,^{circ }hbox {C}). Fig. 3 The mold pieces were assembled and filled using PDMS (Sylgard 184 from Dow Corning). This was prepared by combining PDMS prepolymer with a curing agent (10 to 1 w/w). After filling the mold with PDMS, it was vacuumed for an hour in a chamber. The PDMS-filled mold should be left to cure for 24 hours (60,^{circ }hbox {C}) Before removing the PDMS mold.
Assembly of microfluidic chip
Borosilicate glass substrates ((101.6hbox {mm} times 127.0hbox {mm})McMaster-Carr) were washed in acetone (10 minutes), followed by isopropyl alcohol (10 minutes), and finally dried with N2. The glass substrate and molded PDMS surface were activated at 50 W for 45 s with oxygen plasma (Fig. 4C) were aligned manually, pressed together and baked at (100,^{circ }hbox {C}) For 30 minutes, place the seal on a hot plate.
Parylene coating
A 10 (upmu hbox {m}) To prevent PDMS absorption by small molecules, a layer of parylene C (Specialty Coating Systems), was deposited onto the microfluidic chips. To promote adhesion, two drops of silane A-174 (Sigma-Aldrich), were added to the chamber.
Components 3D printed
Figure. 4F was 3D printed to interface the 2.2 mm OD microbore tube (Cole-Palmer), with the PDMS outlet and inlet features. Each connector geometry had 24 cylindrical extrusions that had an OD of 2.5 mm and bore of 2.2mm. To grip the microbore tubing, there were three 0.2mm-long barbs within each bore. The component was printed using a Formlabs SLA printer, Form 2, with Surgical Guide resin. After printing, the component was sonicated in isopropanol (IPA), for 20 minutes to remove excess resin. Finally, it was dried in N2. After drying, dry components were cured with UV light (405nm for 30 min). (60,^{circ }hbox {C}). 5 was used to coat the part in order to ensure biocompatibility. (upmu hbox {m}) parylene C (Specialty Coating Systems). In the deposition chamber, two drops silane A-174 (Sigma-Aldrich), was also loaded to promote adhesion.
Organoid cell culture
Sterilization
According to Tecan’s supplier recommendations, sterilization of the syringe pumps, valve heads and tubing was performed. The platform was then pushed through to the collection reservoirs using the syringe pump for a 10-minute wash of 70% ethanol. After 70% ethanol has been removed, sterile air was filtered through a 0.22 to dry the mixture. (upmu hbox {m}) The filter (Millipore), had to be applied for ten minutes. The same parameters were used for ten subsequent cycles of deionized and nucleus-free water as well as drying. The microfluidic chip, media reservoirs and were autoclaved. (121^{circ }hbox {C}) After 45 minutes, allow to dry for 15 minutes before using. All components were placed in sealed autoclavable bags into a biosafety cabinet for tissue culture to allow media loading and organoid loading. Each media reservoir was filled with pre-prepared and supplemented media. The media reservoirs were then sealed (VapLock), and stored in refrigeration until the end of the experiment.
Maintenance of the hESC line
The human embryonic and stem cell line H9 (WiCell), authenticated at source, was grown on StemFlex Medium (Gibco), recombinant Human Vitronectin (Thermo), coated cell culture dishes. Subculturing was done by incubating plates in 0.5 mM EDTA over 5 minutes. The plates were then resuspended with culture medium and transferred to new coated plates.
Protocol and differentiation of the cerebral organoid.
Accutase Cell Disociation Reagent was used to dissociate adherent cultures into single cells. These cells were then aggregated on AggreWell 800 24-well plates from STEMCELL Technologies at a density three million cells per well. The medium (STEMCELL Technologies), contained 2mL AggreWell Media (STEMCELL Technologies) and Rho Kinase inhibitor (Y-27632, 10, 10). (upmu hbox {M}), Tocris, 1254) (day 0). Day 1, 1mL AggreWell medium was replaced manually with supplemented medium containing WNT inhibitors (IWR1-).(varepsilon), 3 (upmu hbox {M})Cayman Chemical, 1359, days 1-10) and Nodal/Activin inhibit (SB431542, Tocris 1614, 5 (upmu hbox {M})Days 1-10 Day 2: Aggregates were transferred onto a 37 (upmu hbox {m}) Filter (STEMCELL Technologies) was obtained by carefully aspirating the AggreWell plates with a wide-bore pipette. By inverting the organoids and rinsing with AggreWell medium, they were transferred to ultra-low adhesion 6-well plates. The media were changed on the days 3, 5, 6, 8, 8 and 10. This was done by manually replacing 2mL of conditioned medium with fresh media. On day 11 and onward, the medium was changed to Neuronal Differentiation Medium containing Eagle Medium: Nutrient Mixture F-12 with GlutaMAX supplement (DMEM/F12, Thermo Fisher Scientific, 10565018), 1X N-2 Supplement (Thermo Fisher Scientific, 17502048), 1X Chemically Defined Lipid Concentrate (Thermo Fisher Scientific, 11905031) and 100 U/mL Penicillin/Streptomycin supplemented with 0.1% recombinant human Fibroblast Growth Factor b (Alamone F-170) and 0.1% recombinant human Epidermal Growth Factor (R &D systems 236-EG).
Control-group “Suspension” organoids remained suspended in 6-well plates and were maintained with 2 mL media changes every other day for the remainder of the culture. Experimental-group “Automated” organoids were loaded onto the microfluidic chip and experienced media changes of 70 (upmu hbox {L}) The rest of the culture is offered once per hour.
Microfluidic chip loading
The microfluidic chip for cerebral organoid differentiation was prepared on day 12 by pipetting 50 (upmu hbox {L}) Chilled (approximately (0,^{circ }hbox {C})) Matrigel hESC Qualif Matrix (BD 354277) into each well. One cerebral organoids were transferred using a p1000 widebore pipette containing 70 (upmu hbox {L}) Apply native media to each well, and position the chip to the center-well to allow for imaging. Cover the chip with a 24-well plate cover and let it incubate for 24 hours. (37^{circ }hbox {C}) For 15 minutes, the Matrigel should be set. Each well was filled in with additional 70 (upmu hbox {L}) fresh media, and connected to fluidic interplates (Fig. 4F) were routed through the rear access port to the incubator. The microfluidic chips were pressure-fitted into the fluidic interface plates by hand. If applicable, the chip was then positioned on an imaging platform.
Analyse
Preparation for a sequencing library
Protocol Smart-seq236 This was used to create full-length cDNA sequencing library from whole organoid mRNA. Briefly, whole organoids were lysed using lysis buffer to render cell lysate containing polyadenylated mRNAs that were reverse transcribed with Superscript III (ThermoFisher Scientific) using an oligoDT primer (/5Me-isodC/AAGCAGTGGTATCAACGCAGA GTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN) and template switching was performed with a template switch oligo (AAGCAGTGGTATCAACGCAGAGTACATrGrGrG). The oligoDT primer and template switch oligo sequences served as primer sites for downstream cDNA amplification (AAGCAGTGGTATCAACGCAGAGT). Qubit 3.0 DNA sensitivity fluorometric test was used to measure cDNA. Agilent was used for quality control. Nextera HT Transposase (Illumina), was used for the conversion of 1 ng cDNA to barcoded sequencing library.
Analysis of the transcriptome
Paired-end reads were sequenced at 75 × 75 bp on an Illumina NextSeq 550, and further depth was sequenced at 50×50 bp on an Illumina NovaSeq 6000 to an average read depth of 65 million paired reads per sample. Illumina i5 or i7 barcodes were used for demultiplexing samples. Higher depth samples were sub-sampled at 100M with SAMtools.37. The trimmed reads were combined with STAR alignment and aligned to human genome (hg38 UCSC assembly).38 (Gencode V37) Using the toil-rnaseq pipe39. STAR parameters came from ENCODE’s DCC pipeline40. The DESeq2 was used for differential gene expression.41 Package in RStudio g:Profiler was used to analyze gene set enrichment.42.
Immunostaining
The cerebral organoids were taken, then fixed in 4% paraffindehyde (ThermoFisher Scientific #28908), washed with 1X PBS, and then submerged into a 30% sucrose (Millipore® Sigma #S8501) in PBS solution. Samples were embedded in cryomolds (Sakura – Tissue-Tek Cryomold) containing tissue freezing medium (General Data, TFM-C), frozen and stored at − (80,^{circ }hbox {C}). At 18 (upmu hbox {M}) Onto glass slides. The organoids sections were then washed three-times in 1X PBS for 10 minutes before being incubated in 10% BSA in PBS blocking solutions (ThermoFisher Scientific #BP1605100). After washing the sections, they were incubated with primary antibodies that had been diluted in blocking solution for overnight. (4^{circ }hbox {C}). The sections were then washed three time with 1X BSP for 30 minutes. The sections were then incubated for 30 minutes in 1X PBS with secondary antibodies.
Primary antibodies were used: Rabbit anti SOX2 (1:50 dilution), Chicken anti Nestin (1:50 dilution) and DAPI (10mg) Secondary antibodies used were: Goat anti-rabbit Alexa Fluor 594 (150080, 1:250) and goat Anti-Chicken Alexa Fluor 488 (1150169, 1:250) The Zeiss AxioimagerZ2 Widefield Microscope was used at the UC Santa Cruz Institute for the Biology of Stem Cells (RRID :SCR_021135). Zen Pro software was also used. ImageJ was used to process the images.
Computational fluid dynamics
The fluid dynamics of filling and draining the wells were predicted using a commercial Computational Fluid Dynamics software COMSOL®Multiphysics 5.5 (Stockholm, Sweden). Figure 5B shows the filling cycle’s first 2 s ((70, {upmu }hbox {L}) Media delivered with an average velocity (9.85 times 10^4,hbox {m/s})). The well is (5,hbox {mm}) The diameter is approximately 3.5 inches. (5.6,hbox {mm}). In this simulation, media properties were (997,hbox {kg/m}^3) Density (6.92 times 10^3,hbox {kg/ms}) viscosity. The simulation predicts the surface of the phase boundary between liquid and air as a free-surface.43. The solution domain consists of a rigid wall (the well) with “non-slip” boundary conditions and the top surface (the air-media interface) open to the incubator with “slip” boundary conditions. The organoid geometry was represented as a phantom globe geometry. (1.8,hbox {mm}) diameter. The atmospheric conditions were adjusted to a pressure of (1,hbox {atm})A temperature of (37,^{circ }hbox {C}), and a composition of a gas. (5%) carbon dioxide, (17%) Oxygen, and (78%) nitrogen. The velocity field was visualized using stream arrows lines. Simulation used 519,830 total tetrahedral components.